| |
- Enter the list of genes or search terms in any order, with any separators.
- qPCR Technology: The tool automatically searches for matches to gene name (ie. "HFM1"), gene alias ("MER3"),
gene description ("helicase"), or Entrez or Ensembl IDs. If you are having trouble finding a match, use
shorter search terms (ie. "tubb" will return "TUBB1, TUBB2A, TUBB2B". You can also search for sequence matches (ie. ACAGCAGGCCAAGAACGATTCAGGTCTGTGACAAGAAGCTACTAC).
to the MIQE context sequence of the assay. Mousing over the orange gene name
will show you the description and aliases of that gene.
- ddPCR Technology: You can also search for nucleotide mutation (c.1798G>A, or even 1798) and/or amino acid
change (p.V600M, or V600M). To search for all genes on a chromosome, enter chr followed by the chromosme number (chr12, chrX). Additionally, you can filter by application (copy number or mutation detection),
and display recommended reference assays.
- Clicking on any orange link will redirect you to the PrimePCR website for more detail.
|
|
|
